Skip to main content

Table 1 Detailed information of primers

From: The effect of biomechanical stimulation on osteoblast differentiation of human jaw periosteum-derived stem cells

Gene name Sequence Product size (bp) Tm (°C)
Osteocalcin AGAGACCCAGGCGCTACCT 259 62.3
CTGGGAGGTCAGGGCAAG 59.33
Osteopontin GGTCACTGATTTTCCCACGG 274 58.83
GTCCTTCCCACGGCTGTC 60.05
Osteonectin TGGAGGCAGGAGACCACC 271 60.61
TCCTTCTGCTTGATGCCG 57.38
VEGF CCACCATGCCAAGTGGTC 307 58.31
CATCTCTCCTATGTGCTGGC 57.83
Alkaline phosphatase-1 TTTGGTGGATACACCCCC 176 56.05
GCCTGGTAGTTGTTGTGAGC 59.12
GAPDH ACTGGCATGGCCTTCCGT 289 61.65
CCACCCTGTTGCTGTAGCC 60.68